Menu

Persistance et résistance aux antiviraux du virus de la varicelle et du zona chez les patients hématologiques

July 30, 2020 0 Comment

Les infections à VZV sont une cause importante de morbidité et de mortalité chez les patients hématologiques et en particulier chez les receveurs de greffe de cellules souches hématopoïétiques. La présente étude visait à étudier la prévalence et la signification clinique de la persistance virale et de la résistance antivirale en analysant systématiquement tous les épisodes de VZV Méthodes Les tableaux de patients ont été examinés pour documenter les caractéristiques des patients et des maladies. Les charges de VZV ont été déterminées dans tous les échantillons cliniques disponibles à partir du jour du diagnostic et par la suite. L’infection persistante par VZV a été définie comme une infection par VZV. Au moins jours L’analyse de la résistance a été réalisée chez tous les patients présentant une infection persistante au VZV par analyse séquentielle des gènes de la thymidine kinase et de l’ADN polymérase. Résultats Au total, des épisodes sont survenus chez des patients ayant reçu une HSCT allogénique. Dans les épisodes persistants% des épisodes persistants ont présenté des manifestations persistantes de VZV% des épisodes non persistants% Des mutations pouvant être associées à une résistance ont été observées chez% des patients présentant un VZV persistant, y compris chez des patients présentant un zona dermatomal insensible au traitement. Chez les patients hématologiques, les complications liées au VZV surviennent fréquemment, en particulier dans les infections persistantes. La résistance aux antiviraux est un facteur pertinent dans les infections persistantes et doit être étudiée dans divers sites corporels affectés, en particulier lorsque la suspicion clinique d’échec thérapeutique survient

VZV, persistance, résistance antivirale, HSCT, patients hématologiquesVaricella zoster virus Les réactivations VZV peuvent être dermatomimétiques mais aussi disséminées chez les patients gravement immunodéprimés Après une greffe de cellules souches hématopoïétiques, des infections à VHC, viscérales, rétiniennes et neurologiques peuvent survenir et entraîner une morbidité grave. mortalité La plupart des réactivations du VZV répondent au traitement par acyclovir ACV, valacyclovir vACV ou agents antiviraux apparentés , mais des infections persistantes et progressives peuvent survenir malgré traitement Ceci peut être dû à un échec immunologique à contrôler la réplication virale [, -] ou à des niveaux de médicaments insuffisants, mais la résistance du virus au traitement antiviral a également été décrite La résistance du VZV aux médicaments antiviraux n’a pas été rapportée chez les patients immunocompétents atteints d’infections primaires au VZV ou d’herpès zoster ont été démontrés chez des patients atteints du SIDA, des patients hémato-oncologiques et des receveurs de HSCT avec un VZ sans traitement. Réactivations V La prévalence de la résistance aux antiviraux et sa contribution relative aux infections persistantes au VZV chez les patients hémato-oncologiques et les receveurs de HSCT sont inconnues car seuls les cas et séries de cas ont été publiés jusqu’à présent. L’analyse systématique de l’occurrence et de la localisation du VZV résistant chez les patients immunodéprimés avec un VZV persistant peut guider le traitement et le diagnostic de la résistance au VZV chez ce groupe de patients. Le but de cette étude était de déterminer la prévalence et l’importance clinique des infections persistantes au VZV et la contribution de la résistance antivirale à la persistance chez les patients hémato-oncologiques, y compris les receveurs de la greffe de CSH

PATIENTS ET MÉTHODES

Données patient

Les patients du centre hospitalier universitaire de Leiden, hôpital de soins tertiaires et d’enseignement aux Pays-Bas, atteints de tumeurs malignes hématologiques et de receveurs HSCT adultes et enfants diagnostiqués avec un laboratoire VZV confirmé par une amplification en chaîne par polymérase et / ou une culture entre janvier et janvier ont été identifiés. Les complications liées au VZV ont été classées en récurrence en cas de réapparition de lésions cutanées après régression initiale et en cas de progression de lésions cutanées en dehors des dermatomes initialement et adjacents ou se propager aux organes viscéraux, à l’œil et / ou au système nerveux central SNC

Traitement antiviral

Dans notre hôpital, les patients immunodéprimés infectés par le VZV sont généralement traités par ACV intraveineux pendant au moins jours. La prophylaxie par ACV ou vACV n’était pas systématiquement administrée. Les données individuelles de traitement antiviral ont été obtenues à partir de la base de données hospitalière et des dossiers médicaux.

Détermination de la charge VZV

La fréquence d’échantillonnage pour le suivi a été laissée à la discrétion du médecin traitant. Les échantillons originaux utilisés pour le diagnostic du VZV ont été retestés pour confirmation. Les charges VZV ont également été déterminées dans tous les échantillons cliniques disponibles à partir du jour du diagnostic et ensuite jusqu’à des échantillons consécutifs négatifs au VZV. Des échantillons de plasma d’acide éthylènediaminetétraacétique envoyés au laboratoire pour d’autres diagnostics que le VZV ont également été inclus. Échantillons inclus écouvillons de lésions cutanées, plasma, sérum, LCR du liquide céphalorachidien, humeur aqueuse et échantillons de lavage broncho-alvéolaire Échantillons BAL persistante définie comme une infection par le VZV a été isolé avec le kit MagNA Pure LC d’acide nucléique total – haute performance en utilisant un instrument MagNA Pure LC Roche Diagnostics, Almere, Pays-Bas Un PCR multiplex en temps réel pour le VZV et l’herpèsvirus phociné comme contrôle interne pour l’extraction d’ADN et l’inhibition de la PCR a été effectuée sur un système de détection CFX en temps réel Bio-Rad, Veenendaal, Pays-Bas, comme décrit précédemment Pour la quantification, un étalon d’isolat de culture cultivé VZV ou de souche American Type Culture Collection KOS a été étalonné en utilisant un contrôle d’ADN quantitatif Advanced Biotechnologies Inc, Columbia, MD

Analyse de la résistance

L’analyse de la résistance a été réalisée chez tous les patients présentant une infection persistante au VZV. Le premier échantillon positif de chaque patient a été analysé ainsi que les échantillons positifs au VZV subséquents. La résistance a été analysée dans des échantillons provenant de différents sites corporels. amplification de l’ensemble du gène thymidine kinase tk La limite de détection du test était de copies / mL En cas de possibles mutations tk associées à la résistance ou chez des patients traités par foscarnet FOS ou cidofovir CDV, partie du gène pol ADN polymérase contenant la plus grande résistance précédemment décrite Les amorces d’amplification et de séquençage et les conditions de PCR sont montrées dans le tableau symptomatologie. Les amorces additionnelles ont été utilisées pour confirmer la délétion du codon chez le patient. L’amplification a été réalisée dans un volume de μL contenant μL de HotStart Taq Master Mix Qiagen , Hilden, Allemagne et pmol de chaque amorce Toutes les réactions de séquençage Une analyse de séquence a été réalisée sur un ABI Prism Genetic Analyzer. Les séquences de Biosystems Applied ont été comparées à la séquence de la souche de Dumas GenBank, en vue de l’obtention d’un produit d’amplification en vrac contenant μL BigDye Terminator v Applied Biosystems, Carlsbad, CA nombre NC_ et aux échantillons de prétraitement du patient

Amorces de Tableau et Conditions de Réaction en Chaîne de Polymérase Séquence d’Orientation de Cible ‘→’ Position Amplicon taille nt Protocole de PCR tk amplification du gène CCGTCCCAGAAGATAACC – ‘° C ×: “° C” ° C’ ° C CGCGAGTATGACAATGTGT tk Séquençage du gène CCGTCCCAGAAGATAACC – ‘° C ×: ” CGCCGCTTCCTGGGTTA CGCGAGTATGACAATGTGT TGACTGGGGAGTGAAAC amplification et séquençage du codon du gène tk GCCGTTTGTTATGGTTCTGA ‘° C ×: ° C ° ° C’ ° C amplification GGCGAATAACGTGTCTTCAA ‘° C ×: “° C” ° C’ ° C séquençage pol amplification génique Fragment AACGGTCTCATATCTCTGGA ‘° C ×: “° C” ° C’ ° C amplification TCGATATAAAATCCCGTATCA Fragment GAGATGGATGAAGACGAGAG ‘° C ×: “° C” ° C’ ° C amplification ACACTAACACCCTTGAATCG Séquençage du gène pol Fragment AACGGTCTCATATCTCTGGA ‘° C ×: “° C ” C ‘° C TGCAAGGCTAGCTAGAATTA TAATTCTAGCTAGCCTTGCA TCGATATAAAATCCCGTATCA Fragment GAGATGGATGAAGACGAGAG AGATGAAGCAGTGTTATTAG CTAATAACACTGCTTCATCT ACACTAACACCCTTGAATCG cible Orientation Sequence’ → ‘Position des amplicon taille nt PCR Protocol amplification du gène de la tk CCGTCCCAGAAGATAACC -‘ ° C x: “° C” ° C “° C CGCGAGTATGACAATGTGT séquençage gène tk CCGTCCCAGAAGATAACC – ‘ CGCGAGTATGACAATGTGT TGACTGGGGAGTGAAAC amplification et séquençage du codage du gène tk GCCGTTTGTTATGGTTCTGA ‘° C x: “° C” ° C’ ° C amplification GGCGAATAACGTGTCTTCAA ‘° C ×: “° C” ° C ° C x: “° C” ° C ° C CGGCGCTTCCTGGGTTA ‘° C séquençage amplification du gène pol Fragment AACGGTCTCATATCTCTGGA’ ° C ×: “° C” ° C ‘° C amplification TCGATATAAAATCCCGTATCA Fragment GAGAT ‘° C x: “° C” ° C “GGATGAAGACGAGAG ° C amplification ACACTAACACCCTTGAATCG pol séquençage du gène Fragment AACGGTCTCATATCTCTGGA’ ° de C x:” ° C “° C” ° C TGCAAGGCTAGCTAGAATTA TAATTCTAGCTAGCCTTGCA TCGATATAAAATCCCGTATCA Fragment GAGATGGATGAAGACGAGAG AGATGAAGCAGTGTTATTAG CTAATAACACTGCTTCATCT ACACTAACACCCTTGAATCG Abréviations: nt, nucleotides; PCR, polymerase chain reactiona A partir du codon de départ dans le gène dans l’orientation sensVoir Grand

RÉSULTATS

Patients et épisodes

Les caractéristiques des patients inclus sont présentées dans le tableau des patients,% étaient des receveurs de HSCT allogénique chez qui les épisodes de VZV sont survenus en médiane des jours après la gamme HSCT, – jours à années VZV est survenue significativement plus tôt après HSCT chez les enfants que chez les HSCT adultes médiane, vs jours, P & lt; , Test de Mann-Whitney

Tableau Caractéristiques du patient Total Cohorte, No% Cohort avec échantillons de suivi, No% Age Child & lt; y Adulte ≥ y Sexe Masculin Féminin Maladie hématologique ALL AML CLL LMC Syndrome myélodysplasique Lymphome hodgkinien Lymphome non hodgkinien Myélome multiple Anémie aplasique Thalassémie Autre Traitement hématologique Chimiothérapie Autologue HSCT NMA HSCT MA HSCT Autre type de donneur HSCT Haploidentical MSD MUD Sang de cordon Total Total Cohorte, Non % Cohorte avec échantillons de suivi, No% Age Child & lt; y Adulte ≥ y Sexe Homme Femme Maladie hématologique ALL AML CLL LMC Syndrome myélodysplasique Lymphome hodgkinien Lymphome non hodgkinien Myélome multiple Anémie aplasique Thalassémie Autre Traitement hématologique Chimiothérapie Autologue HSCT NMA HSCT MA HSCT Autre type de donneur HSCT Haploidentical MSD MUD Sang de cordon Total Abréviations: ALL, leucémie lymphoblastique aiguë; AML, leucémie myéloïde aiguë; CLL, leucémie lymphoïde chronique; LMC, leucémie myéloïde chronique; HSCT, greffe de cellules souches hématopoïétiques; MA, conditionnement myéloablatif; MSD, donneur jumeau apparié; MUD, donneur non apparenté apparié; Le premier épisode de varicelle est survenu chez un patient séronégatif, alors que tous les autres épisodes étaient des cas de zona chez des patients séropositifs. Un patient a présenté des épisodes distincts de VZV avec des mois ou des années entre les épisodes. en épisodes%; % intervalle de confiance [IC],% -% et comprenait la récurrence, la dissémination, la rétinite, l’encéphalite, d’autres complications et des épisodes durant lesquels des patients sont décédés en association avec d’autres problèmes infectieux et / ou hématologiques. les épisodes% où le traitement a été documenté

Tableau Varicelle Zona Virus Épisodes Cohorte totale, No% Cohorte avec échantillons de suivi, Non% Présentation Varicelle Dermatome Généralisée cutanée Viscérale / œil / SNC Inconnue Traitement antiviral Aucune vACV ACV ACV vACV ACV FOS ACV vACV FOS ACV FOS CDV Inconnu Complication Aucune Récurrence Dissémination Rétinite Encéphalite Décès Autre Total Cohorte totale, No% Cohorte avec échantillons de suivi, Non% Présentation Varicelle Dermatome Généralisée cutanée Viscérale / œil / SNC Inconnue Traitement antiviral Aucun vACV ACV ACV vACV ACV FOS ACV vACV FOS ACV FOS CDV Inconnu Complication Aucune Récurrence DisséminationRétinite Encéphalite mort Autres Total Abréviations: ACV, acyclovir; CDV, cidofovir; SNC, système nerveux central; FOS, foscarnet; vACV, valacyclovirView Large

Données virologiques

Le VZV a été détecté lors de la présentation initiale dans les échantillons de plasma dans les épisodes%, dans le plasma et les écouvillons dans les épisodes%, dans les écouvillons seulement dans les épisodes%, dans les échantillons de plasma et de BAL dans les épisodes% les échantillons au diagnostic était; × copies / mL Des échantillons de plasma étaient disponibles au moment du diagnostic dans les épisodes et étaient positifs dans les épisodes% avec une charge virale moyenne de; × copies / mL Parmi les patients présentant un zona dermatomal au moment de la présentation,% présentaient un ADN plasmatique du VZV positif, alors que tous les patients présentant un zona généralisé ou viscéral comme manifestation initiale présentaient un plasma à ADN VZV positif

Suivi des patients

En moyenne, des échantillons étaient disponibles par épisode Des échantillons de suivi étaient disponibles pendant au moins une semaine après le diagnostic des épisodes chez les patients Les caractéristiques de ces patients et épisodes sont présentées dans les Tableaux et En raison de la nature rétrospective de l’étude, le suivi était disponible chez les receveurs de HSCT comparé aux patients non transplantés, vs vs, P =, Test t de Student et dans les épisodes avec VZV compliqué comparé à VZV moyen, vs, P & lt; , Test t de Student

Persistance de VZV

VZV persistant a été démontré dans des épisodes avec suivi%; % CI,% -% Les échantillons plasmatiques étaient positifs par PCR dans les épisodes persistants et n’étaient pas disponibles pour les épisodes restants où seuls des prélèvements positifs étaient disponibles. Autres types d’échantillons en plus du plasma étaient disponibles et positifs dans les épisodes persistants non associé à l’apparition de la persistance Persistance dans tous les épisodes de VZV chez les patients ayant un donneur haploïdal n = et chez le seul patient avec donneur de sang ombilical Un traitement antiviral a été administré par épisodes et inconnu dans les épisodes Persistance après arrêt du traitement antiviral dans les épisodes % et pendant le traitement antiviral dans les épisodes% La durée médiane de la positivité du VZV était de plusieurs jours, – jours dans les épisodes persistants La charge maximale de VZV dans le plasma était plus élevée dans les épisodes persistants que dans les épisodes non persistants. × copies / mL vs; × copies / mL, P =, test de Mann-WhitneyComplications dans les épisodes persistants%; % CI,% -% vs des épisodes non persistants%; % CI,% -%, P =, χ test, Figure Chez les patients pédiatriques, les épisodes compliqués sont survenus plus tôt après la TCSH que les épisodes non compliqués médiane vs jours, P =, Mann-Whitney test chez les patients adultes Le traitement de conditionnement n’a pas été associé à des complications Trois des patients avec un donneur haplo-identique et le seul receveur d’une greffe de sang de cordon ont souffert de complications

Figure Vue largeTélécharger DiapositiveOccurrence de la persistance, des complications et de la résistance Les épisodes avec des échantillons de suivi au moins une semaine après le diagnostic sont représentés n = La ligne pointillée sépare non persistante n = des épisodes persistants du virus varicelle-zona durée au moins une semaine, n = Épisodes compliqués n = sont représentés par des barres grises et des épisodes avec un virus résistant n = sont indiqués en noir Abréviation: VZV, varicelle zona virusFigure Voir grandDownload slideOccurrence de persistance, complications et résistance Les épisodes avec des échantillons de suivi au moins une semaine après le diagnostic sont représentés n = The point ligne sépare non persistant n = des épisodes persistants du virus varicelle-zona durée au moins une semaine, n = épisodes compliqués n = sont représentés par des barres grises et épisodes avec virus résistant n = sont indiqués en noir Abréviation: VZV, virus varicelle-zona

La résistance

L’analyse de la résistance pourrait être effectuée dans les épisodes persistants, car dans les épisodes, la charge VZV était soit insuffisante pour permettre l’analyse de la séquence ou des échantillons étaient indisponibles Mutations développées pendant la persistance du%; % CI,% -% patients étudiés Tableau, Figure Deux patients patients et avaient des mutations dans VKV TK qui avait précédemment été associée à la résistance à l’ACV Dans l’un des patients patients, nous avons trouvé à la fois codon d’arrêt prématuré caractérisé et et nouvelles mutations et les numéros d’accès GenBank JQ et JQ Ces mutations ont été alternativement présentes dans les échantillons de plasma et de LCR subséquents. Deux patients ont présenté des mutations qui n’ont pas été décrites en association avec une résistance avant que le patient présente une délétion dans l’ADN du VZV. Le patient présentait différentes mutations précédemment non caractérisées TI et PS, les numéros d’accession GenBank JQ et JQ dans différents échantillons, tous deux étant des domaines conservés ou fonctionnels de VKV TK, faisant leur rôle de résistance. mutations associées peu claires Une mutation de l’ADN polymérase de signification inconnue SN, GenBank accessio n numéro JQ a été trouvé chez le patient après traitement avec ACV, FOS et CDV Cette mutation est en dehors des domaines fonctionnels de l’ADN polymérase virale, mais des mutations adjacentes au codon et ont été associées à la résistance FOS Aucune mutation associée à la résistance trouvé dans le gène de l’ADN polymérase dans des échantillons provenant de patients atteints de mutations tk

s, ACV et vACV Aucun écouvillon Aucun lésions cutanées persistantes, kératite Aucun écouvillon Aucun lésions cutanées progressives, convulsions, encéphalites, ACV et FOS delAAC – & gt; DelAAC de jour de del codon plasma – & gt; del codon CSF jour ND, aucun Néant jour du plasma Convulsions, ACV et FOS, récupération ND ND Féminin, y, AML, NMA HSCT, d, MUD Douleurs abdominales, pneumonie, convulsions, et VZV cutané généralisé, ACV iv d Aucun plasma, écouvillon Aucun Lésions cutanées récurrentes après traitement, jours iv d’ACV avec réponse rapide Aucun jour de plasma -, aucun TC – & gt; TI mélange, jour de plasma Aucun suivi de traitement avec vACV, CT de récupération – & gt; PS jour plasma Aucun Aucun jour plasma Femelle, y, thalassémie, MA HSCT, – d, MSD Zona facial, ACV iv ND ND Zona persistant et dissémination dans la région pubienne, ACV iv et FOS iv et CDV iv réactivation concomitante d’adénovirus Aucun tampon Aucun Lésions cutanées récurrentes, FOS iv et CDV topique, récupération Aucun écouvillon GA – & gt; SN Plasma ND Plasma ND Caractéristiques du patient Jours depuis le diagnostic Détails cliniques / thérapeutiques au moment de l’échantillonnage Mutations dans le gène tk Mutations dans le gène pol Femelle, y, LMC, MA HSCT, d, MSD Pneumonie et VZV cutané généralisé, ACV iv d Aucun plasma, écouvillon, BAL Aucun Lésions cutanées récurrentes après cessation du traitement, ACV iv avec une bonne réponse AG – & gt; EG plasma, écouvillon Aucun Deuxième récidive sous traitement par ACV iv, FOS iv, récupération ND ND Femelle, y, AML, MA HSCT, d, donneur haploïdal Zoster du bras gauche, de la main et de l’épaule, ACV iv et vACV ND NDZ le bras, vACV Aucun plasma ND Nécrose rétinienne externe progressive, FOS iv, perte de vision dans l’oeil affecté, récupération AddC – & gt; arrêter l’humeur aqueuse ND plasma ND Mâle, y, protoporphyrie érythropoïétique, OLTx, MA HSCT, d, donneur haploidentical zona faciale, vACV ND ND Zoster oticus persistant, ACV iv delA – & gt; arrêter plasma ND Zoster amélioré, l’hépatite, le traitement de suivi avec vACV delC – & gt; arrêter le jour de plasma, aucun CT – & gt; arrêter le jour de plasma, aucun CT – & gt; arrêter le plasma jour Aucun zona persistant, céphalées progressives et perte de la vision, ACV iv et FOS iv delA – & gt; stop plasma, CSF Aucun Aucun écouvillon Perte de la vision dans les deux yeux, décès dû à une défaillance de l’organe delA – & gt; stop CSF Aucune Mâle, y, ALL, MA HSCT, d, donneur de sang de cordon Zoster n ophtalmicus, ACV et vACV Aucun écouvillon Aucun lésions cutanées persistantes, kératite Aucun écouvillon Aucun lésions cutanées progressives, convulsions, encéphalites, ACV et FOS delAAC – & gt; DelAAC de jour de del codon plasma – & gt; del codon CSF jour ND, aucun Néant jour du plasma Convulsions, ACV et FOS, récupération ND ND Féminin, y, AML, NMA HSCT, d, MUD Douleurs abdominales, pneumonie, convulsions, et VZV cutané généralisé, ACV iv d Aucun plasma, écouvillon Aucun Lésions cutanées récurrentes après traitement, jours iv d’ACV avec réponse rapide Aucun jour de plasma -, aucun TC – & gt; TI mélange, jour de plasma Aucun suivi de traitement avec vACV, CT de récupération – & gt; PS jour plasma Aucun Aucun jour plasma Femelle, y, thalassémie, MA HSCT, – d, MSD Zona facial, ACV iv ND ND Zona persistant et dissémination dans la région pubienne, ACV iv et FOS iv et CDV iv réactivation concomitante d’adénovirus Aucun tampon Aucun Lésions cutanées récurrentes, FOS iv et CDV topique, récupération Aucun écouvillon GA – & gt; SN Plasma ND Plasma ND Les mutations conférant une résistance sont représentées en gras, de nouvelles mutations en italique. Abréviations: ACV, acyclovir; ALL, leucémie lymphoblastique aiguë; AML, leucémie myéloïde aiguë; ajouter, addition; BAL, lavage broncho-alvéolaire; CDV, cidofovir; LMC, leucémie myéloïde chronique; del, deletion; FOS, foscarnet; HSCT, greffe de cellules souches hématopoïétiques; iv, par voie intraveineuse; MA, conditionnement myéloablatif; MSD, donneur jumeau apparié; MUD, donneur non apparenté apparié; ND, non déterminé, en raison d’une charge trop faible pour l’analyse de résistance ou d’un échantillon non disponible; NMA, conditionnement non myéloablatif; OLTx, transplantation hépatique orthotopique; vACV, valacyclovir; VZV, varicella zoster virusView LargeClinical détails sur les patients avec des mutations dans VZV tk et pol sont présentés dans le tableau Deux patients adultes HSCT patient et présenté avec des lésions cutanées récurrentes qui ont bien réagi au retraitement avec ACV One patient patient pédiatrique présenté avec zona cutanée persistante qui a finalement En revanche, les patients pédiatriques et les patients présentant un VZV résistant présentaient un zona dermatomal non réactif au traitement qui évoluait vers une infection rétinienne sévère avec un résultat défavorable. Un patient pédiatrique présentait des lésions cutanées persistantes et une kératite évoluant vers une encéphalite. Tous les patients présentant des mutations du VZV développaient VZV- complications liées, vs%; % CI,% -% patients avec VZV persistant sans mutations P =, test exact de Fisher La durée médiane du VZV était de jours, – jours chez les patients avec VZV persistant avec des mutations vs jours, – jours chez les patients avec VZV persistant sans mutations P =, Test de Mann-Whitney

DISCUSSION

La persistance biologique peut prédire des complications Nos résultats sont en accord avec la constatation précédente que l’évolution clinique du VZV est corrélée à la charge plasmatique Chez les patients pédiatriques, l’infection par le VZV précoce était associée à une fréquence plus élevée de complications. par l’état immunosuppresseur sévère du patient à ce moment Chez les patients adultes, cette relation n’a pas été trouvée, peut-être en raison de différences dans les protocoles de transplantation ou dans l’apparition de la maladie du greffon contre l’hôte. En% des épisodes de VZV persistant, des mutations possibles associées à la résistance ont été détectées, suggérant une résistance potentielle aux antiviraux. La résistance aux antiviraux est le résultat de mutations spontanées au cours de la maladie. réplication virale, en particulier lorsque les niveaux de réplication sont élevés en raison à l’absence d’immunité antivirale adéquate A la pression de sélection par l’administration d’un agent antiviral, en particulier pendant un traitement prolongé et lorsqu’il n’y a pas d’inhibition complète de la réplication virale, comme dans les sites présentant une faible pénétration du médicament, comme le LCR ou l’oeil Dans notre étude, une résistance a été observée à différents moments après le diagnostic et également dans divers sites incluant le SNC et les yeux. Fait intéressant, le patient avait même différentes mutations qui n’ont jamais été détectées simultanément sous traitement continu par vACV et ACV Un séquençage supplémentaire et une PCR en temps réel avec des sondes spécifiques ont échoué à identifier divers virus mutants dans un seul échantillon, probablement en raison de la charge relativement faible des variants dans le échantillons de données non montrés Bien que les mutations de résistance antivirale se soient produites à une fréquence plutôt élevée, les l’insuffisance des aliments ne peut pas toujours s’expliquer par une résistance antivirale, car un manque d’immunité antivirale ou un dosage insuffisant d’antiviraux peuvent également jouer un rôle. Ces facteurs soulignent la nécessité de diagnostics rapides et complets dans les cas de VZV compliqués et persistants chez les patients immunodéprimés. la majorité du VZV a été détectée dans des échantillons dont le VZV ne peut pas être cultivé , l’analyse de la séquence nucléotidique des gènes les plus impliqués dans la résistance antivirale [,,,,] a été choisie pour diagnostiquer la résistance. parce qu’ils sont apparus sous thérapie antivirale Cependant, en raison de l’absence d’isolats viraux, nous n’avons pas pu confirmer leur contribution réelle à la résistance, qui reste à établir. La comparaison des séquences entre prétraitement et sur traitement d’un patient peut partiellement résoudre ce problème Les études de transfert de marqueur peuvent être une autre approche, mais ne sont pas systématiquement disponibles dans la plupart des laboratoires. Les limites s’appliquent à notre étude Premièrement, en raison de la nature rétrospective de l’étude, plus d’échantillons étaient probablement disponibles chez des patients présentant une infection cliniquement persistante ou compliquée chez qui le clinicien traitant a trouvé une indication pour le diagnostic et le suivi. un biais de sélection vers plus de persistance et plus de complications dans la partie de notre cohorte qui avait suffisamment d’échantillons de suivi est probable, malgré le fait qu’environ% des échantillons inclus étaient des échantillons de plasma soumis pour d’autres demandes de diagnostic. Deuxièmement, en raison des limites de la sensibilité de l’analyse de la séquence par rapport au test de diagnostic, la résistance n’a pas pu être déterminée chez les patients ayant de faibles charges de VZV. , et donc le rôle potentiel dans la persistance à faible niveau ne pourrait pas être L’ADN du VZV extrait des échantillons de liquide céphalorachidien et d’œil était souvent difficile à amplifier. Ceci peut être lié à des charges virales faibles dans certains de ces échantillons, mais peut aussi être dû à la présence d’ADN viral fragmenté. Efficacité de la prophylaxie à long terme par ACV ou vACV dans la prévention du VZV après HSCT Beaucoup de patients de notre cohorte étaient des receveurs de HSCT, et le VZV se produisait à un large intervalle de temps après la HSCT. Complications liées au VZV dans les périodes d’immunodéficience maximale après HSCT Cependant, le moment optimal et le dosage restent à établir. En conclusion, chez les patients hématologiques, les complications liées au VZV surviennent fréquemment, particulièrement dans les infections persistantes. La résistance aux antiviraux est un facteur pertinent de persistance. être étudiés en temps opportun et dans des échantillons provenant de divers sites corporels dès que la suspicion clinique ou virologique de persistance ou d’autres complications es

Remarques

Remerciements Nous remercions J Gallert pour son assistance technique Conflits d’intérêts potentiels Tous les auteurs: Aucun conflit signaléTous les auteurs ont soumis le formulaire ICMJE pour la divulgation des conflits d’intérêts potentiels Conflits que les éditeurs considèrent pertinents pour le contenu du manuscrit ont été divulgués